Stem-loop sequence aae-mir-71

AccessionMI0013440 (change log)
DescriptionAedes aegypti miR-71 stem-loop
Gene family MIPF0000278; mir-71
Literature search

1 open access papers mention aae-mir-71
(1 sentences)

Stem-loop
   --     a        u            aguuuca   uau 
5'   cggca gaaagaca ggguagugagau       ccc   u
     ||||| |||||||| ||||||||||||       |||   g
3'   gucgu cuuucugu uccaucacucua       ggg   c
   ua     a        -            -------   uca 
Get sequence
Deep sequencing
163561 reads, 8.15e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.268: 889378-889454 [-]
intergenic
Clustered miRNAs
< 10kb from aae-mir-71
aae-mir-71supercont1.268: 889378-889454 [-]
aae-mir-2csupercont1.268: 889085-889162 [-]
aae-mir-13supercont1.268: 888736-888819 [-]
aae-mir-2asupercont1.268: 888581-888677 [-]
aae-mir-2bsupercont1.268: 887244-887330 [-]
Database links

Mature sequence aae-miR-71-5p

Accession MIMAT0014220
Previous IDsaae-miR-71
Sequence

6 - 

agaaagacauggguagugagau

 - 27

Get sequence
Deep sequencing162537 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-71-3p

Accession MIMAT0014221
Previous IDsaae-miR-71*
Sequence

51 - 

ucucacuaccuugucuuucaug

 - 72

Get sequence
Deep sequencing1024 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).