Stem-loop sequence aae-mir-71

Accession

MI0013440 (change log)

Description

Aedes aegypti miR-71 stem-loop

Gene family

MIPF0000278; mir-71

Literature search

1 open access papers mention aae-mir-71
(1 sentences)

Stem-loop

   --     a        u            aguuuca   uau 
5'   cggca gaaagaca ggguagugagau       ccc   u
     ||||| |||||||| ||||||||||||       |||   g
3'   gucgu cuuucugu uccaucacucua       ggg   c
   ua     a        -            -------   uca 

Deep sequencing

163561 reads, 8.15e+03 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context

• Coordinates (AaegL1): supercont1.268: 889378-889454 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from aae-mir-71

• aae-mir-71: supercont1.268: 889378-889454 [-]
• aae-mir-2c: supercont1.268: 889085-889162 [-]
• aae-mir-13: supercont1.268: 888736-888819 [-]
• aae-mir-2a: supercont1.268: 888581-888677 [-]
• aae-mir-2b: supercont1.268: 887244-887330 [-]

Database links

• miRBase Tracker:MI0013440

Mature sequence aae-miR-71-5p

• Accession: MIMAT0014220
• Previous IDs: aae-miR-71
• Sequence: 6 - agaaagacauggguagugagau - 27
• Deep sequencing: 162537 reads, 2 experiments
• Evidence: experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-71-3p

• Accession: MIMAT0014221
• Previous IDs: aae-miR-71*
• Sequence: 51 - ucucacuaccuugucuuucaug - 72
• Deep sequencing: 1024 reads, 2 experiments
• Evidence: experimental; 454 [1], Illumina [2]

References

1. PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2. PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).