![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aae-mir-71 |
||||||||||||
Accession | MI0013440 (change log) | |||||||||||
Description | Aedes aegypti miR-71 stem-loop | |||||||||||
Gene family | MIPF0000278; mir-71 | |||||||||||
Literature search |
1 open access papers mention aae-mir-71 | |||||||||||
Stem-loop |
-- a u aguuuca uau 5' cggca gaaagaca ggguagugagau ccc u ||||| |||||||| |||||||||||| ||| g 3' gucgu cuuucugu uccaucacucua ggg c ua a - ------- uca |
|||||||||||
Deep sequencing |
| |||||||||||
Confidence |
Annotation confidence: high
| |||||||||||
Comments |
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2]. |
|||||||||||
Genome context |
|
|||||||||||
Clustered miRNAs |
|
|||||||||||
Database links |
|
Mature sequence aae-miR-71-5p |
|
Accession | MIMAT0014220 |
Previous IDs | aae-miR-71 |
Sequence |
6 - agaaagacauggguagugagau - 27 |
Deep sequencing | 162537 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
Mature sequence aae-miR-71-3p |
|
Accession | MIMAT0014221 |
Previous IDs | aae-miR-71* |
Sequence |
51 - ucucacuaccuugucuuucaug - 72 |
Deep sequencing | 1024 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 | |
2 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|