Stem-loop sequence aae-mir-1889

AccessionMI0013448 (change log)
DescriptionAedes aegypti miR-1889 stem-loop
Gene family MIPF0000954; mir-1889
Literature search

3 open access papers mention aae-mir-1889
(14 sentences)

Stem-loop
   ga  u        a       a      ugauuuuccuggugaaucccggccuuguccuccgu 
5'   gg aaucucaa uuguaac gugggu                                   c
     || |||||||| ||||||| ||||||                                   a
3'   cc uugggguu gacauug caccca                                   c
   cc  u        a       -      uaucgcuugugcaaaagcucugugaacagugugaa 
Get sequence
Deep sequencing
2791 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.68: 2720794-2720921 [-]
intergenic
Clustered miRNAs
< 10kb from aae-mir-1889
aae-mir-283supercont1.68: 2729329-2729431 [-]
aae-mir-1889supercont1.68: 2720794-2720921 [-]
aae-mir-12supercont1.68: 2720396-2720497 [-]
Database links

Mature sequence aae-miR-1889-5p

Accession MIMAT0014233
Previous IDsaae-miR-1889*
Sequence

5 - 

uaaucucaaauuguaacagugg

 - 26

Get sequence
Deep sequencing1380 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence aae-miR-1889-3p

Accession MIMAT0014234
Previous IDsaae-miR-1889
Sequence

105 - 

cacguuacagauugggguuucc

 - 126

Get sequence
Deep sequencing1411 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).