![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aae-mir-14 |
|||||
Accession | MI0013452 (change log) | ||||
Description | Aedes aegypti miR-14 stem-loop | ||||
Gene family | MIPF0000182; mir-14 | ||||
Literature search |
![]()
2 open access papers mention aae-mir-14 | ||||
Stem-loop |
------ -- accucaac a ugcucu - a a u c uu u ggucauuu 5' gugga auuac gaauuug acuc ac ccg ua gcc gugggag gaga aaggcu gcu a ||||| ||||| ||||||| |||| || ||| || ||| ||||||| |||| |||||| ||| u 3' caccu ugaug cuugagc ugag ug ggc au ugg uauccuc cucu uucuga uga u cuacua ac -ccacgcc c caacuu u a a u u uu c agcucaca |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence aae-miR-14 |
|
Accession | MIMAT0014240 |
Sequence |
95 - ucagucuuuuucucucuccuau - 116 |
Deep sequencing | 31835 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 | |
2 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|