Stem-loop sequence aae-mir-14

AccessionMI0013452 (change log)
DescriptionAedes aegypti miR-14 stem-loop
Gene family MIPF0000182; mir-14
Literature search

2 open access papers mention aae-mir-14
(23 sentences)

Stem-loop 
   ------     --     accucaac       a    ugcucu  -   a  a   u       c    uu      u   ggucauuu 
5'       gugga  auuac        gaauuug acuc      ac ccg ua gcc gugggag gaga  aaggcu gcu        a
         |||||  |||||        ||||||| ||||      || ||| || ||| ||||||| ||||  |||||| |||        u
3'       caccu  ugaug        cuugagc ugag      ug ggc au ugg uauccuc cucu  uucuga uga        u
   cuacua     ac     -ccacgcc       c    caacuu  u   a  a   u       u    uu      c   agcucaca
Get sequence
Deep sequencing
32095 reads, 1.55e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.249: 1088962-1089134 [-]
intergenic
Database links

Mature sequence aae-miR-14

Accession MIMAT0014240
Sequence

95 -  

ucagucuuuuucucucuccuau

 - 116

Get sequence
Deep sequencing31835 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).