Stem-loop sequence aae-mir-34

Accession

MI0013456 (change log)

Description

Aedes aegypti miR-34 stem-loop

Gene family

MIPF0000039; mir-34

Literature search

5 open access papers mention aae-mir-34
(22 sentences)

Stem-loop

   caa    aua   ua      u    u   c        uagaacu  ggg           -    u 
5'    ggca   cgc  uggcag gugg uag ugguugug       uu   gggcuuccgug gcgu c
      ||||   |||  |||||| |||| ||| ||||||||       ||   ||||||||||| ||||  
3'    ccgu   gcg  gccguc cgcc auc accaacac       ag   cucgggggcac cgcg g
   gga    gga   cc      c    u   -        -----uu  --a           a    c 

Deep sequencing

939266 reads, 4.56e+04 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context

• Coordinates (AaegL1): supercont1.265: 509521-509649 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from aae-mir-34

• aae-mir-277: supercont1.265: 508799-508893 [+]
• aae-mir-34: supercont1.265: 509521-509649 [+]

Database links

• miRBase Tracker:MI0013456

Mature sequence aae-miR-34-5p

• Accession: MIMAT0014245
• Previous IDs: aae-miR-34
• Sequence: 16 - uggcagugugguuagcugguug - 37
• Deep sequencing: 937694 reads, 2 experiments
• Evidence: experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-34-3p

• Accession: MIMAT0014246
• Previous IDs: aae-miR-34*
• Sequence: 94 - caaccacuauccgcccugccgcc - 116
• Deep sequencing: 1228 reads, 2 experiments
• Evidence: experimental; Illumina [2]

References

1. PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2. PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).