![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aae-mir-996 |
||||||
Accession | MI0013460 (change log) | |||||
Description | Aedes aegypti miR-996 stem-loop | |||||
Gene family | MIPF0000449; mir-996 | |||||
Literature search |
2 open access papers mention aae-mir-996 | |||||
Stem-loop |
aa u c u - g uuuuccagu 5' cucaauuu cgu ggcg gcaug aaucuggu cacgg u |||||||| ||| |||| ||||| |||||||| ||||| g 3' gaguugaa gua cugc cguac uuagauca gugcu u ua - u u a - ucgcuauaa |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Comments |
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence aae-miR-996 |
|
Accession | MIMAT0014251 |
Sequence |
64 - ugacuagauuacaugcucguc - 84 |
Deep sequencing | 118946 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 | |
2 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|