Stem-loop sequence aae-mir-996

AccessionMI0013460 (change log)
DescriptionAedes aegypti miR-996 stem-loop
Gene family MIPF0000449; mir-996
Literature search

2 open access papers mention aae-mir-996
(2 sentences)

Stem-loop 
   aa        u   c    u     -        g     uuuuccagu 
5'   cucaauuu cgu ggcg gcaug aaucuggu cacgg         u
     |||||||| ||| |||| ||||| |||||||| |||||         g
3'   gaguugaa gua cugc cguac uuagauca gugcu         u
   ua        -   u    u     a        -     ucgcuauaa
Get sequence
Deep sequencing
118987 reads, 5.95e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.437: 567493-567590 [-]
intergenic
Clustered miRNAs
< 10kb from aae-mir-996
aae-mir-279supercont1.437: 572245-572339 [-]
aae-mir-996supercont1.437: 567493-567590 [-]
Database links

Mature sequence aae-miR-996

Accession MIMAT0014251
Sequence

64 -  

ugacuagauuacaugcucguc

 - 84

Get sequence
Deep sequencing118946 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).