Stem-loop sequence aae-mir-87

AccessionMI0013461 (change log)
DescriptionAedes aegypti miR-87 stem-loop
Gene family MIPF0000152; mir-87
Stem-loop
   ----acca      - a     ca        -      aa    ---g   guauu 
5'         gauugu c cuggc  gccugaaa uuugcu  accu    ugu     u
           |||||| | |||||  |||||||| ||||||  ||||    |||     g
3'         cuaaca g ggcug  uggacuuu aaacga  ugga    aca     a
   uacuaacg      a a     ug        u      -g    acua   aacuu 
Get sequence
Deep sequencing
2724 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.360: 1010781-1010887 [+]
intergenic
Database links

Mature sequence aae-miR-87

Accession MIMAT0014252
Sequence

66 - 

gugagcaaauuuucaggugugu

 - 87

Get sequence
Deep sequencing2704 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).