![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aae-mir-12 |
||||||||
Accession | MI0013462 (change log) | |||||||
Description | Aedes aegypti miR-12 stem-loop | |||||||
Gene family | MIPF0000181; mir-12 | |||||||
Literature search |
![]()
6 open access papers mention aae-mir-12 | |||||||
Stem-loop |
uu cu u c ------ ---u a ac 5' cgga gaguau acau agguacuggu gucga auucga uc c |||| |||||| |||| |||||||||| ||||| |||||| || 3' gccu cucgua ugua uucaugacca uaguu ugggcu ag a -- cu u - uucaau uccu a ca |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Comments |
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2]. |
|||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence aae-miR-12-5p |
|
Accession | MIMAT0014253 |
Previous IDs | aae-miR-12 |
Sequence |
8 - ugaguauuacaucagguacuggu - 30 |
Deep sequencing | 22291 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
Mature sequence aae-miR-12-3p |
|
Accession | MIMAT0014254 |
Previous IDs | aae-miR-12* |
Sequence |
78 - caguacuuauguuaugcucucu - 99 |
Deep sequencing | 85 reads, 2 experiments |
Evidence | experimental; Illumina [2] |
References |
|
1 | |
2 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|