Stem-loop sequence aae-mir-12

Accession

MI0013462 (change log)

Description

Aedes aegypti miR-12 stem-loop

Gene family

MIPF0000181; mir-12

Literature search

6 open access papers mention aae-mir-12
(79 sentences)

Stem-loop

   uu    cu      u    c          ------     ---u      a  ac 
5'   cgga  gaguau acau agguacuggu      gucga    auucga uc  c
     ||||  |||||| |||| ||||||||||      |||||    |||||| ||   
3'   gccu  cucgua ugua uucaugacca      uaguu    ugggcu ag  a
   --    cu      u    -          uucaau     uccu      a  ca 

Deep sequencing

22376 reads, 1.05e+03 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context

• Coordinates (AaegL1): supercont1.68: 2720396-2720497 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from aae-mir-12

• aae-mir-283: supercont1.68: 2729329-2729431 [-]
• aae-mir-1889: supercont1.68: 2720794-2720921 [-]
• aae-mir-12: supercont1.68: 2720396-2720497 [-]

Database links

• miRBase Tracker:MI0013462

Mature sequence aae-miR-12-5p

• Accession: MIMAT0014253
• Previous IDs: aae-miR-12
• Sequence: 8 - ugaguauuacaucagguacuggu - 30
• Deep sequencing: 22291 reads, 2 experiments
• Evidence: experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-12-3p

• Accession: MIMAT0014254
• Previous IDs: aae-miR-12*
• Sequence: 78 - caguacuuauguuaugcucucu - 99
• Deep sequencing: 85 reads, 2 experiments
• Evidence: experimental; Illumina [2]

References

1. PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2. PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).