Stem-loop sequence aae-mir-283

AccessionMI0013486 (change log)
DescriptionAedes aegypti miR-283 stem-loop
Gene family MIPF0000054; mir-216
Literature search

4 open access papers mention aae-mir-283
(7 sentences)

Stem-loop 
   ------g              ca       c   u         cuuaccccac 
5'        uucgacugaaaggu  auaucag ugg aauucuggg          c
          ||||||||||||||  ||||||| ||| |||||||||           
3'        gagcugauuuuuca  uauaguc acc uuaaggccc          g
   acuggua              cc       a   -         uucgcauauu
Get sequence
Deep sequencing
4327 reads, 200 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.68: 2729329-2729431 [-]
intergenic
Clustered miRNAs
< 10kb from aae-mir-283
aae-mir-283supercont1.68: 2729329-2729431 [-]
aae-mir-1889supercont1.68: 2720794-2720921 [-]
aae-mir-12supercont1.68: 2720396-2720497 [-]
Database links

Mature sequence aae-miR-283

Accession MIMAT0014279
Sequence

16 -  

caauaucagcugguaauucugggc

 - 39

Get sequence
Deep sequencing4318 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).