Stem-loop sequence aae-mir-2765

AccessionMI0013490 (change log)
DescriptionAedes aegypti miR-2765 stem-loop
Gene family MIPF0001008; mir-2765
Literature search

1 open access papers mention aae-mir-2765
(1 sentences)

Stem-loop
   -a      uc   a  c   u       - ca        gaua 
5'   aacguu  cgg gc ugg aacucca c  ccguuggc    u
     ||||||  ||| || ||| ||||||| |  ||||||||    u
3'   uugcaa  gcc ug gcc uugaggu g  gguaaccg    u
   ac      --   g  c   c       c ag        acag 
Get sequence
Deep sequencing
1661 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was experimentally identified in the closely related Aedes albopictus, for which there was no genome sequence, and therefore mapped to the Aedes aegypti genome [1].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.1: 5248294-5248380 [+]
intergenic
Database links

Mature sequence aae-miR-2765

Accession MIMAT0014285
Sequence

17 - 

ugguaacuccaccaccguuggc

 - 38

Get sequence
Deep sequencing1661 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).