Stem-loop sequence aae-mir-7

AccessionMI0013496 (change log)
DescriptionAedes aegypti miR-7 stem-loop
Gene family MIPF0000022; mir-7
Literature search

1 open access papers mention aae-mir-7
(1 sentences)

Stem-loop
   uc    u        u        a u     --       -   c 
5'   gcaa auuuugua ggaagacu g gauuu  uguuguu uug u
     |||| |||||||| |||||||| | |||||  ||||||| |||  
3'   cguu ugaaacau cuuucuga c cuaaa  acaauaa agc u
   gu    -        -        a u     ua       u   a 
Get sequence
Deep sequencing
65184 reads, 3.15e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.1359: 46026-46114 [+]
intergenic
Database links

Mature sequence aae-miR-7

Accession MIMAT0014290
Sequence

16 - 

uggaagacuagugauuuuguugu

 - 38

Get sequence
Deep sequencing65150 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).