Stem-loop sequence aae-mir-970

Accession MI0013498
Description Aedes aegypti miR-970 stem-loop
Gene family MIPF0000700; mir-970
Stem-loop 
aac   -a   cg       u        u    u       gc       gaau 
   ggu  uug  gcuuuca agguagcu gcgu ugucuua  ugguauu    g
   |||  |||  ||||||| |||||||| |||| |||||||  |||||||     
   cua  aac  ugagagu uuuaucgg cgca acagaau  acuaugg    u
guu   cg   ua       u        -    c       --       auag
Get sequence
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.229: 1045811-1045918 [+]
intergenic

Mature sequence aae-miR-970

Accession MIMAT0014292
Sequence

65 -  

ucauaagacacacgcggcuau

 - 85

Get sequence
Evidence experimental; 454 [1], Solexa [2]

References

1
PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).