Stem-loop sequence hsv2-mir-H7

AccessionMI0013558 (change log)
DescriptionHerpes Simplex Virus 2 miR-H7 stem-loop
Gene family MIPF0000929; mir-H7
Stem-loop
          -a       c uaa       -  g 
5' ggggaga  agggguc g   ccaaagg ug u
   |||||||  ||||||| |   ||||||| || c
3' ccccucu  uccccag c   gguuucc gc u
          gc       c uua       u  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsv2-miR-H7-5p

Accession MIMAT0014351
Sequence

7 - 

aaagggguccguaaccaaagg

 - 27

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence hsv2-miR-H7-3p

Accession MIMAT0015375
Sequence

40 - 

uuuggauuccgaccccucguc

 - 60

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:19889786 "Identification of viral microRNAs expressed in human sacral ganglia latently infected with herpes simplex virus 2" Umbach JL, Wang K, Tang S, Krause PR, Mont EK, Cohen JI, Cullen BR J Virol. 84:1189-1192(2010).
2
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).