Stem-loop sequence cqu-mir-1174

AccessionMI0013561 (change log)
DescriptionCulex quinquefasciatus miR-1174 stem-loop
Literature search

1 open access papers mention cqu-mir-1174
(7 sentences)

Stem-loop
   -          uuu   uc    --    aguu 
5'  uucuggguau   aga  aucg  gcau    u
    ||||||||||   |||  ||||  ||||     
3'  gagacccaug   ucu  uagc  cgua    a
   g          ccu   -u    ag    agag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.86: 865899-865962 [+]
intergenic
Clustered miRNAs
< 10kb from cqu-mir-1174
cqu-mir-1174supercont3.86: 865899-865962 [+]
cqu-mir-1175supercont3.86: 866094-866196 [+]
Database links

Mature sequence cqu-miR-1174

Accession MIMAT0014354
Sequence

3 - 

cuggguauuuuagaucaucggc

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).