Stem-loop sequence cqu-mir-125

AccessionMI0013562 (change log)
DescriptionCulex quinquefasciatus miR-125 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   uu       uuu        uc  u    c cu         --  aua 
5'   aguuuug   cugcugau  cc gaga c  aacuuguga  cu   g
     |||||||   ||||||||  || |||| |  |||||||||  ||    
3'   uuagagc   ggcgauua  gg cucu g  uugaacacu  ga   u
   ac       --u        -u  c    a uu         uu  agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.4: 280955-281049 [+]
intergenic
Clustered miRNAs
< 10kb from cqu-mir-125
cqu-mir-100supercont3.4: 271392-271501 [+]
cqu-let-7supercont3.4: 280595-280685 [+]
cqu-mir-125supercont3.4: 280955-281049 [+]
Database links

Mature sequence cqu-miR-125-5p

Accession MIMAT0014355
Previous IDscqu-miR-125
Sequence

21 - 

ucccugagacccuaacuuguga

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-miR-125-3p

Accession MIMAT0014356
Previous IDscqu-miR-125*
Sequence

57 - 

ucacaaguuuugaucuccgguau

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).