Stem-loop sequence cqu-let-7

AccessionMI0013570 (change log)
DescriptionCulex quinquefasciatus let-7 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention cqu-let-7
(2 sentences)

Stem-loop
   uc  u    c   --      g    u            uuaaaaa 
5'   gc gcuc cac  guugag uagu gguuguauagua       u
     || |||| |||  |||||| |||| ||||||||||||        
3'   cg cggg gug  caauuc aucg cuaacguaucau       u
   uc  -    a   uu      g    c            cuauaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.4: 280595-280685 [+]
intergenic
Clustered miRNAs
< 10kb from cqu-let-7
cqu-mir-100supercont3.4: 271392-271501 [+]
cqu-let-7supercont3.4: 280595-280685 [+]
cqu-mir-125supercont3.4: 280955-281049 [+]
Database links

Mature sequence cqu-let-7-5p

Accession MIMAT0014366
Previous IDscqu-let-7
Sequence

16 - 

ugagguaguugguuguauagu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-let-7-3p

Accession MIMAT0014367
Previous IDscqu-let-7*
Sequence

56 - 

cuaugcaauccgcuagcuuaac

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).