Stem-loop sequence cqu-mir-989

AccessionMI0013586 (change log)
DescriptionCulex quinquefasciatus miR-989 stem-loop
Gene family MIPF0000885; mir-989
Literature search

1 open access papers mention cqu-mir-989
(16 sentences)

Stem-loop
   -acuc     u      -ac        c    uu    u   u  ccaua a 
5'      gguca ggggaa   gccgcuac ucgc  ucac ugg gg     g u
        ||||| ||||||   |||||||| ||||  |||| ||| ||     |  
3'      ucggu ucccuu   uggugaug agug  agug acc cu     c u
   ccuua     -      cca        c    -u    u   -  -auag u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.315: 321300-321401 [+]
intergenic
Database links

Mature sequence cqu-miR-989

Accession MIMAT0014389
Sequence

65 - 

ugugaugugacguagugguac

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).