Stem-loop sequence cqu-mir-276-1

AccessionMI0013588 (change log)
DescriptionCulex quinquefasciatus miR-276-1 stem-loop
Gene family MIPF0000124; mir-276
Literature search

1 open access papers mention cqu-mir-276-1
(3 sentences)

Stem-loop
   ------   uuu      u  c   cu    a     ag          c  --   uu 
5'       gag   gaaagu ca ccg  agcg gguau  aguuccuaug gu  uga  g
         |||   |||||| || |||  |||| |||||  |||||||||| ||  |||   
3'       cuu   cuuucg gu ggu  ucgu ccaua  ucaaggauac ua  gcu  g
   agacua   -gc      -  a   uc    g     cu          c  uc   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.136: 340846-340955 [+]
intergenic
Database links

Mature sequence cqu-miR-276-5p

Accession MIMAT0014392
Previous IDscqu-miR-276*
Sequence

22 - 

agcgagguauagaguuccu

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-miR-276-3p

Accession MIMAT0014393
Previous IDscqu-miR-276
Sequence

66 - 

uaggaacuucauaccgugcucu

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).