|
miRBase |
|
Stem-loop sequence cqu-mir-190-2 |
|||||
| Accession | MI0013597 | ||||
| Description | Culex quinquefasciatus miR-190-2 stem-loop | ||||
| Gene family | MIPF0000076; mir-190 | ||||
| Stem-loop |
g uc - au u u auu ggugau cgguga gauauguuugau ucuugg ug uaa u |||||| |||||| |||||||||||| |||||| || ||| cuacug gucauu uuauacaaacua aggacc ac auu u - gu a -- c u aua |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
Mature sequence cqu-miR-190 |
|
| Accession | MIMAT0014402 |
| Sequence |
15 - agauauguuugauauucuugguug - 38 |
| Deep sequencing | 230 reads, 1 experiments |
| Evidence | experimental; Solexa [1] |
References |
|
| 1 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|