Stem-loop sequence cqu-bantam

AccessionMI0013610 (change log)
DescriptionCulex quinquefasciatus bantam stem-loop
Gene family MIPF0000153; bantam
Literature search

1 open access papers mention cqu-bantam
(3 sentences)

Stem-loop
   agaac         uuuuc     g    auuug 
5'      cgguuuuca     gaucu acuu     a
        |||||||||     ||||| ||||     u
3'      gucgaaagu     cuaga ugag     u
   uuuua         -uuua     g    acaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.65: 199694-199763 [-]
intergenic
Database links

Mature sequence cqu-bantam-5p

Accession MIMAT0014420
Previous IDscqu-bantam
Sequence

5 - 

ccgguuuucauuuucgaucugac

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-bantam-3p

Accession MIMAT0014421
Previous IDscqu-bantam*
Sequence

46 - 

ugagaucauuuugaaagcuga

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).