Stem-loop sequence tgu-mir-2984

AccessionMI0013682 (change log)
DescriptionTaeniopygia guttata miR-2984 stem-loop
Literature search

1 open access papers mention tgu-mir-2984
(2 sentences)

Stem-loop
   u            - a        a           auaaa  aca  a 
5'  gcuucaccugcg g gccugcug gagugaaauug     gg   gc c
    |||||||||||| | |||||||| |||||||||||     ||   ||  
3'  cgaaguggacgu c cgggcgac cucacuuuaac     cc   cg c
   a            u a        a           --gga  ---  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr1: 39743243-39743336 [-]
sense
ENSTGUT00000011415 ; TM9SF2-201; intron 1
Database links

Mature sequence tgu-miR-2984-5p

Accession MIMAT0014494
Sequence

15 - 

agccugcugagagugaaauug

 - 35

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence tgu-miR-2984-3p

Accession MIMAT0026970
Sequence

60 - 

aauuucacucacagcgggcacuu

 - 82

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).