Stem-loop sequence tgu-mir-148a

AccessionMI0013693 (change log)
DescriptionTaeniopygia guttata miR-148a stem-loop
Gene family MIPF0000056; mir-148
Stem-loop
   ccccggcgccgguaccggcggaggacugga   u     ag            --a    cc    -   gg 
5'                               gcc ccgga  caaaguucugug   cacu  gacu cug  u
                                 ||| |||||  ||||||||||||   ||||  |||| |||  a
3'                               cgg ggccu  guuucaagacau   guga  cuga gau  c
   ------------------------------   c     cu            cac    --    c   ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr2: 52006663-52006774 [-]
intergenic
Clustered miRNAs
< 10kb from tgu-mir-148a
tgu-mir-148bchr2: 52006667-52006740 [+]
tgu-mir-148achr2: 52006663-52006774 [-]
Database links

Mature sequence tgu-miR-148a-5p

Accession MIMAT0026973
Sequence

43 - 

aaaguucugugacacuccgacu

 - 64

Get sequence
Evidence experimental; Illumina [2]

Mature sequence tgu-miR-148a-3p

Accession MIMAT0014503
Sequence

81 - 

ucagugcacuacagaacuuugu

 - 102

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).