Stem-loop sequence tgu-mir-128-1

AccessionMI0013712
DescriptionTaeniopygia guttata miR-128-1 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   -------   uuc       uaa      cu       u 
5'        gga   ggggccg   cacugu  gagaggu u
          |||   |||||||   ||||||  |||||||  
3'        cuu   cucuggc   gugaca  cucuuua a
   ucgucga   uuu       caa      --       c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr7: 33186771-33186841 [+]
sense
ENSTGUT00000018258 ; tgu-mir-128-1-201; exon 1
ENSTGUT00000012261 ; R3HDM1-201; intron 16

Mature sequence tgu-miR-128-1-5p

Accession MIMAT0031084
Sequence

6 - 

cggggccguaacacugucuga

 - 26

Get sequence
Evidence experimental; Illumina [2]

Mature sequence tgu-miR-128-3p

Accession MIMAT0014513
Previous IDstgu-miR-128
Sequence

41 - 

ucacagugaaccggucucuuu

 - 61

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).