Stem-loop sequence tgu-let-7a-3

AccessionMI0013723 (change log)
DescriptionTaeniopygia guttata let-7a-3 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention tgu-let-7a-3
(3 sentences)

Stem-loop
   a    ---    u   gu                uuagggucauac 
5'  cugu   ggga gag  aguagguuguauaguu            c
    ||||   |||| |||  ||||||||||||||||            c
3'  gacg   uccu uuc  ucaucuaacauaucaa            a
   c    aaa    -   ug                uagagggucacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr12: 772013-772103 [+]
sense
ENSTGUT00000018306 ; tgu-let-7a-3-201; exon 1
Clustered miRNAs
< 10kb from tgu-let-7a-3
tgu-let-7a-3chr12: 772013-772103 [+]
tgu-let-7fchr12: 772417-772508 [+]
tgu-let-7dchr12: 773412-773503 [+]
tgu-mir-2987chr12: 776733-776812 [+]
Database links

Mature sequence tgu-let-7a-5p

Accession MIMAT0014519
Previous IDstgu-let-7a
Sequence

10 - 

ugagguaguagguuguauaguu

 - 31

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).