Stem-loop sequence tgu-mir-99-1

AccessionMI0013734 (change log)
DescriptionTaeniopygia guttata miR-99-1 stem-loop
Gene family MIPF0000033; mir-10
Literature search

1 open access papers mention tgu-mir-99-1
(1 sentences)

Stem-loop
   aauugg    a         uc   u       ugaa 
5'       caua acccguaga  cga cuugugu    a
         |||| |||||||||  ||| |||||||    c
3'       gugu uggguaucu  gcu gaacacg    g
   ------    c         uc   c       ucac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr1: 109661967-109662037 [+]
sense
ENSTGUT00000018365 ; tgu-mir-99-1-201; exon 1
antisense
Clustered miRNAs
< 10kb from tgu-mir-99-1
tgu-mir-99-1chr1: 109661967-109662037 [+]
tgu-let-7c-1chr1: 109662682-109662773 [+]
Database links

Mature sequence tgu-miR-99-5p

Accession MIMAT0014524
Previous IDstgu-miR-99
Sequence

11 - 

aacccguagauccgaucuugu

 - 31

Get sequence
Evidence experimental; 454 [1], Illumina [2]

Mature sequence tgu-miR-99-3p

Accession MIMAT0014635
Previous IDstgu-miR-99*
Sequence

48 - 

caagcucgcuucuaugggucu

 - 68

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).