Stem-loop sequence tgu-mir-21

Accession MI0013739
Description Taeniopygia guttata miR-21 stem-loop
Gene family MIPF0000060; mir-21
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MIRN21. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

microRNA 21 also known as hsa-mir-21 or miRNA21 is a mammalian microRNA that is encoded by the MIR21 gene. MIRN21 was one of the first mammalian microRNAs identified. The mature miR-21 sequence is strongly conserved throughout evolution. The human microRNA-21 gene is located on plus strand of chromosome 17q23.2 (55273409–55273480) within a coding gene TMEM49 (also called vacuole membrane protein). Despite being located in intronic regions of a coding gene in the direction of transcription, it has its own promoter regions and forms a ~3433-nt long primary transcript of miR-21 (known as pri-miR-21) which is independently transcribed. The stem–loop recursor of miR-21(pre-miR-21) resides between nucleotides 2445 and 2516 of pri-miR-21.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
uccugu             a     a     a    ugg 
      cggauagcuuauc gacug uguug cugu   a
      ||||||||||||| ||||| ||||| ||||    
      gucugucggaugg cugac acaac ggua   u
------             -     a     -    cuc 
Get sequence
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr19: 8993795-8993866 [+]
sense

Mature sequence tgu-miR-21-5p

Accession MIMAT0014527
Previous IDs tgu-miR-21
Sequence

11 - 

uagcuuaucagacugauguuga

 - 32

Get sequence
Evidence experimental; 454 [1], Solexa [1]

Mature sequence tgu-miR-21-3p

Accession MIMAT0014636
Previous IDs tgu-miR-21*
Sequence

50 - 

aacaacagucgguaggcugucu

 - 71

Get sequence
Evidence experimental; 454 [1], Solexa [1]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).