Stem-loop sequence tgu-mir-130a

Accession MI0013799
Description Taeniopygia guttata miR-130a stem-loop
Gene family MIPF0000034; mir-130
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop 
---------aga        uc         a  g -  a 
            gcccuuuu  uguuguacu cu g ca u
            ||||||||  ||||||||| || | ||  
            cgggaaaa  auaacguga ga u gu u
gacggucgguua        uu         c  g a  a
Get sequence
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr15: 8478910-8478981 [+]
sense
Clustered miRNAs
< 10kb from tgu-mir-130a
tgu-mir-130a chr15: 8478910-8478981 [+]
tgu-mir-454 chr15: 8486784-8486856 [+]
tgu-mir-130b chr15: 8487921-8488052 [+]

Mature sequence tgu-miR-130a

Accession MIMAT0014573
Sequence

41 -  

cagugcaauauuaaaagggcau

 - 62

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).