Stem-loop sequence tgu-mir-130b

Accession

MI0013805

Description

Taeniopygia guttata miR-130b stem-loop

Gene family

MIPF0000034; mir-130

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma.

Stem-loop

cccccagcccggcagccgccgcagcugcugugccagcgcugggaccaccggccgggcugccccu     cc         a  -  ca g 
                                                                cuuuc  uguugcacu cu gu  c g
                                                                |||||  ||||||||| || ||  |  
                                                                gaaag  auaacguga ga cg  g u
-------------------------------------------------gccgcgugacugcgg     ua         c  g  ac c 

Genome context

• Coordinates (taeGlu3.2.4): chr15: 8487921-8488052 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from tgu-mir-130b

• tgu-mir-130a: chr15: 8478910-8478981 [+]
• tgu-mir-454: chr15: 8486784-8486856 [+]
• tgu-mir-130b: chr15: 8487921-8488052 [+]

Mature sequence tgu-miR-130b-5p

• Accession: MIMAT0014646
• Previous IDs: tgu-miR-130b*
• Sequence: 62 - ccucuuucccuguugcacuacu - 83
• Evidence: experimental; 454 [1]

Mature sequence tgu-miR-130b-3p

• Accession: MIMAT0014578
• Previous IDs: tgu-miR-130b
• Sequence: 101 - cagugcaauaaugaaagggcgu - 122
• Evidence: experimental; 454 [1]

References

1. PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).