Stem-loop sequence api-let-7

AccessionMI0013908 (change log)
DescriptionAcyrthosiphon pisum let-7 stem-loop
Gene family MIPF0000002; let-7
Literature search

3 open access papers mention api-let-7
(25 sentences)

Stem-loop
   --      -               --    uau 
5'   ugaggu aguugguuguauagu  aguu   u
     |||||| |||||||||||||||  ||||    
3'   auuuca ucggcuaacauauca  ucag   a
   uc      a               uu    uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350266.1: 136852-136914 [+]
intergenic
Clustered miRNAs
< 10kb from api-let-7
api-mir-100GL350266.1: 135163-135261 [+]
api-let-7GL350266.1: 136852-136914 [+]
Database links

Mature sequence api-let-7

Accession MIMAT0014709
Sequence

1 - 

ugagguaguugguuguauagu

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).