Stem-loop sequence api-mir-1

AccessionMI0013909 (change log)
DescriptionAcyrthosiphon pisum miR-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

2 open access papers mention api-mir-1
(12 sentences)

Stem-loop
   --           g       g    -  -   ---cg  a   a 
5'   ccguacuucuu uauguuc caua gu gug     cg gcc u
     ||||||||||| ||||||| |||| || |||     || |||  
3'   gguaugaagaa auguaag guau ca cau     gc cgg u
   ga           -       -    g  g   uuuaa  -   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350503.1: 79303-79384 [+]
intergenic
Database links

Mature sequence api-miR-1

Accession MIMAT0014710
Sequence

61 - 

uggaauguaaagaaguauggag

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).