Stem-loop sequence api-mir-315

AccessionMI0013932 (change log)
DescriptionAcyrthosiphon pisum miR-315 stem-loop
Gene family MIPF0000141; mir-315
Literature search

2 open access papers mention api-mir-315
(7 sentences)

Stem-loop
   --uuu           c        ---uuu  u 
5'      ugauuguugcu agaaagcc      ca a
        ||||||||||| ||||||||      || u
3'      acuaauaacga ucuuucgg      gu a
   ccagu           -        uggcau  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350261.1: 57410-57474 [-]
intergenic
Database links

Mature sequence api-miR-315

Accession MIMAT0014730
Sequence

1 - 

uuuugauuguugcucagaaagcc

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).