Stem-loop sequence api-mir-87b

AccessionMI0013940 (change log)
DescriptionAcyrthosiphon pisum miR-87b stem-loop
Gene family MIPF0000152; mir-87
Literature search

1 open access papers mention api-mir-87b
(1 sentences)

Stem-loop
   --u            -    ug    --aa   c 
5'    cgccugaaacuu gcuu  accu    gua a
      |||||||||||| ||||  ||||    |||  
3'    gcggacuuugaa cgag  ugga    cgu u
   ugu            a    --    acua   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349666.1: 1446143-1446205 [+]
intergenic
Clustered miRNAs
< 10kb from api-mir-87b
api-mir-87aGL349666.1: 1445999-1446064 [+]
api-mir-87bGL349666.1: 1446143-1446205 [+]
Database links

Mature sequence api-miR-87b

Accession MIMAT0014738
Sequence

42 - 

gugagcaaaguuucaggcgugu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).