Stem-loop sequence api-mir-87a

AccessionMI0013941 (change log)
DescriptionAcyrthosiphon pisum miR-87a stem-loop
Gene family MIPF0000152; mir-87
Literature search

1 open access papers mention api-mir-87a
(1 sentences)

Stem-loop
   --gg      cu a       a    uguuauu 
5'     gccuga  c uugcuca ccug       g
       ||||||  | ||||||| ||||       a
3'     uggacu  g aacgagu ggau       u
   cgug      uu a       -    uauugca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349666.1: 1445999-1446064 [+]
intergenic
Clustered miRNAs
< 10kb from api-mir-87a
api-mir-87aGL349666.1: 1445999-1446064 [+]
api-mir-87bGL349666.1: 1446143-1446205 [+]
Database links

Mature sequence api-miR-87a

Accession MIMAT0014739
Sequence

45 - 

gugagcaaaguuucaggugugc

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).