Stem-loop sequence hsa-mir-3115

Accession

MI0014127 (change log)

Symbol

HGNC:MIR3115

Description

Homo sapiens miR-3115 stem-loop

Stem-loop

       a    --       c         ----   a 
5' ucug auau  ggguuua uaguuggug    gug a
   |||| ||||  ||||||| |||||||||    |||  
3' agac ugua  uccggau aucaaccgc    uac u
       c    uu       u         ugag   u 

Deep sequencing

517 reads, 29.5 reads per million, 78 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr1: 23044305-23044372 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000008059 ; EPHB2-003; intron 1

  OTTHUMT00000008060 ; EPHB2-001; intron 1

  OTTHUMT00000008061 ; EPHB2-002; intron 1

  ENST00000374630 ; EPHB2-003; intron 1

  ENST00000400191 ; EPHB2-001; intron 1

  ENST00000374632 ; EPHB2-002; intron 1

  ENST00000544305 ; EPHB2-201; intron 1

Database links

• EntrezGene:MIR3115
• HGNC:MIR3115
• RNAcentral:URS0000759AC2_9606
• miRBase Tracker:MI0014127

Mature sequence hsa-miR-3115

• Accession: MIMAT0014977
• Sequence: 6 - auauggguuuacuaguuggu - 25
• Deep sequencing: 501 reads, 77 experiments
• Evidence: experimental; Illumina [1-2]
• Database links:
  • RNAcentral:URS00000BB229_9606
• Predicted targets:
  • TargetMiner:hsa-miR-3115
  • TargetScanVert:hsa-miR-3115
  • miRDB:hsa-miR-3115
  • microrna.org:hsa-miR-3115

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).