Stem-loop sequence bta-mir-2284w

Accession

MI0014497 (change log)

Description

Bos taurus miR-2284w stem-loop

Gene family

MIPF0000747; mir-2284

Literature search

14 open access papers mention bta-mir-2284w
(33 sentences)

Stem-loop

   uuu   -u               -     ug  c      c  c   a 
5'    caa  uauuggguuggccaa gaguu  uu ggguuu uc aua g
      |||  ||||||||||||||| |||||  || |||||| || ||| c
3'    guu  auaacccaaccgguu cucaa  aa uccaaa ag uau u
   -uc   uu               u     gu  c      a  a   g 

Deep sequencing

5873 reads, 18.8 reads per million, 69 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Jin et al. predicted this miRNA bioinformatically in [1], and validated its expression by qPCR in [2].

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chrX: 2676325-2676420 [+]
• Overlapping transcripts:

  sense

  ENSBTAT00000008444 ; DOCK11-201; intron 23

Database links

• EntrezGene:MIR2284W
• miRBase Tracker:MI0014497

Mature sequence bta-miR-2284w

• Accession: MIMAT0017393
• Sequence: 21 - aagaguuuguucggguuucuc - 41
• Deep sequencing: 1034 reads, 64 experiments
• Evidence: experimental; qPCR [2], Illumina [3]
• Predicted targets:
  • TargetScanVert:bta-miR-2284w

References

1. PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).
2. PMID:20423511 "Characterization of microRNA expression in bovine adipose tissues: a potential regulatory mechanism of subcutaneous adipose tissue development" Jin W, Dodson MV, Moore SS, Basarab JA, Guan LL BMC Mol Biol. 11:29(2010).
3. PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).