Stem-loop sequence bta-mir-3432a-2

AccessionMI0014501 (change log)
Previous IDsbta-mir-3432-2
DescriptionBos taurus miR-3432a-2 stem-loop
Gene family MIPF0001187; mir-3432
Literature search

3 open access papers mention bta-mir-3432a-2
(4 sentences)

Stem-loop 
   aaacagccga         a  c               g   ug   a 
5'           cguugcggc ug gggaucuuuaguugu gug  uga u
             ||||||||| || ||||||||||||||| |||  |||  
3'           guaacgucg ac cccuagaaaucaacg cgu  auu u
   -agacuagaa         g  u               a   ug   c
Get sequence
Deep sequencing
5292 reads, 11.8 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Jin et al. predicted this miRNA bioinformatically in [1], and validated its expression by qPCR in [2].

Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr25: 34580890-34580986 [-]
sense
ENSBTAT00000001039 ; HIP1-201; intron 19
Database links

Mature sequence bta-miR-3432a

Accession MIMAT0017396
Previous IDsbta-miR-3432
Sequence

21 -  

ugcgggaucuuuaguuguggug

 - 42

Get sequence
Deep sequencing9409 reads, 68 experiments
Evidence experimental; qPCR [2], Illumina [3]
Predicted targets

References

1
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).
2
PMID:20423511 "Characterization of microRNA expression in bovine adipose tissues: a potential regulatory mechanism of subcutaneous adipose tissue development" Jin W, Dodson MV, Moore SS, Basarab JA, Guan LL BMC Mol Biol. 11:29(2010).
3
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).