Stem-loop sequence ppy-mir-496

AccessionMI0014969 (change log)
DescriptionPongo pygmaeus miR-496 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
         -----uca     u    u        u     gu         uua 
5' cccaag        gguac cgaa ggagguug ccaug  guguucauu   u
   ||||||        ||||| |||| |||||||| |||||  |||||||||    
3' ggguuc        ucaug guuu ccucuaac gguac  uaugaguag   u
         uucuuaac     -    u        c     au         uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 102623301-102623402 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-496
ppy-mir-487achr14: 102614611-102614690 [+]
ppy-mir-382chr14: 102616490-102616565 [+]
ppy-mir-134chr14: 102616871-102616943 [+]
ppy-mir-668chr14: 102617958-102618024 [+]
ppy-mir-485chr14: 102618120-102618192 [+]
ppy-mir-453chr14: 102618891-102618970 [+]
ppy-mir-154chr14: 102622472-102622555 [+]
ppy-mir-496chr14: 102623301-102623402 [+]
ppy-mir-377chr14: 102624784-102624852 [+]
ppy-mir-541chr14: 102627217-102627300 [+]
ppy-mir-409chr14: 102628022-102628100 [+]
ppy-mir-412chr14: 102628169-102628259 [+]
ppy-mir-369chr14: 102628320-102628389 [+]
ppy-mir-410chr14: 102628634-102628713 [+]
ppy-mir-656chr14: 102629436-102629513 [+]
Database links

Mature sequence ppy-miR-496

Accession MIMAT0015917
Sequence

56 - 

ugaguauuacauggccaaucuc

 - 77

Get sequence
Evidence not experimental

References

1