Stem-loop sequence ppy-mir-541

AccessionMI0015039 (change log)
DescriptionPongo pygmaeus miR-541 stem-loop
Gene family MIPF0000213; mir-541
Stem-loop
   -   -u     aaa        c    g uc    u   aaguu 
5'  acg  caggg   ggauucug uguc g  ccac cca     u
    |||  |||||   |||||||| |||| |  |||| |||      
3'  ugu  gucuc   ccuaagac acgg u  ggug ggu     a
   g   uc     agg        -    g --    -   aagac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 102627217-102627300 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-541
ppy-mir-668chr14: 102617958-102618024 [+]
ppy-mir-485chr14: 102618120-102618192 [+]
ppy-mir-453chr14: 102618891-102618970 [+]
ppy-mir-154chr14: 102622472-102622555 [+]
ppy-mir-496chr14: 102623301-102623402 [+]
ppy-mir-377chr14: 102624784-102624852 [+]
ppy-mir-541chr14: 102627217-102627300 [+]
ppy-mir-409chr14: 102628022-102628100 [+]
ppy-mir-412chr14: 102628169-102628259 [+]
ppy-mir-369chr14: 102628320-102628389 [+]
ppy-mir-410chr14: 102628634-102628713 [+]
ppy-mir-656chr14: 102629436-102629513 [+]
Database links

Mature sequence ppy-miR-541

Accession MIMAT0015990
Sequence

54 - 

uggugggcacagaauccggacu

 - 75

Get sequence
Evidence not experimental

References

1