Stem-loop sequence gga-mir-3525

AccessionMI0015384 (change log)
DescriptionGallus gallus miR-3525 stem-loop
Gene family MIPF0001215; mir-3524
Literature search

2 open access papers mention gga-mir-3525
(11 sentences)

Stem-loop
         u       ca         c      g    aacu 
5' gucucu ucagccu  gccauucug gauucu ugau    u
   |||||| |||||||  ||||||||| |||||| ||||     
3' caggga gguuggg  ugguaagau cuaaga acua    u
         u       cc         a      g    agau 
Get sequence
Deep sequencing
10172 reads, 140 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 105832033-105832116 [+]
antisense
ENSGALT00000044735 ; gga-mir-3524a-201; exon 1
Clustered miRNAs
< 10kb from gga-mir-3525
gga-mir-3524achr1: 105832017-105832132 [-]
gga-mir-3525chr1: 105832033-105832116 [+]
Database links

Mature sequence gga-miR-3525

Accession MIMAT0016382
Sequence

15 - 

cagccauucugcgauucuguga

 - 36

Get sequence
Deep sequencing5871 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19891781 "Identification of differentially expressed miRNAs in chicken lung and trachea with avian influenza virus infection by a deep sequencing approach" Wang Y, Brahmakshatriya V, Zhu H, Lupiani B, Reddy SM, Yoon BJ, Gunaratne PH, Kim JH, Chen R, Wang J, Zhou H BMC Genomics. 10:512(2009).