Stem-loop sequence cin-mir-4003a-1

AccessionMI0015522 (change log)
DescriptionCiona intestinalis miR-4003a-1 stem-loop
Gene family MIPF0000840; mir-4003
Stem-loop
   uga        uac        -gg   u 
5'    guugguua   auucuugc   uau a
      ||||||||   ||||||||   |||  
3'    caaccaau   uaagaacg   aug a
   aca        -uu        aca   a 
Get sequence
Deep sequencing
261 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
7q: 6152459-6152516 [-]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4003a-1
cin-mir-4077d7q: 6165860-6165915 [-]
cin-mir-4077b7q: 6155725-6155780 [-]
cin-mir-4003b7q: 6154672-6154730 [-]
cin-mir-4005b7q: 6154057-6154110 [-]
cin-mir-4077d7q: 6153229-6153284 [-]
cin-mir-4003a-17q: 6152459-6152516 [-]
cin-mir-4003c7q: 6151685-6151739 [-]
cin-mir-4077a7q: 6150979-6151034 [-]
cin-mir-4003a-47q: 6150122-6150179 [-]
cin-mir-4003d7q: 6148874-6148927 [-]
Database links

Mature sequence cin-miR-4003a-5p

Accession MIMAT0016461
Sequence

1 - 

ugaguugguuauacauucuu

 - 20

Get sequence
Deep sequencing1038 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4003a-3p

Accession MIMAT0016462
Sequence

39 - 

caagaauuuuaaccaacaca

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1