Stem-loop sequence ssc-mir-4332

AccessionMI0015917 (change log)
DescriptionSus scrofa miR-4332 stem-loop
Literature search

3 open access papers mention ssc-mir-4332
(10 sentences)

Stem-loop
   -   c    -      g   g     g  -  c  -g          g g   gg 
5'  cgg gggg gguguc cgg ggugg cg gg ug  ggccgggggu g gcc  c
    ||| |||| |||||| ||| ||||| || || ||  |||||||||| | |||   
3'  gcc ccuu ccgcgg gcc ccgcc gc cc gc  cuggccccca c cgg  g
   c   a    u      -   g     g  a  u  gg          g a   gg 
Get sequence
Deep sequencing
422 reads, 28.6 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-4332

Accession MIMAT0017962
Sequence

78 - 

cacggccgccgccgggcgcc

 - 97

Get sequence
Deep sequencing264 reads, 11 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).