Stem-loop sequence vvi-MIR2950

AccessionMI0016016 (change log)
DescriptionVitis vinifera miR2950 stem-loop
Gene family MIPF0001121; MIR2950
Literature search

2 open access papers mention vvi-MIR2950
(4 sentences)

Stem-loop
   uggcuua      c ug                u       ug   --    gc 
5'        cauggg u  ugauguauuccaucuc ugcacac  gac  cagc  u
          |||||| |  |||||||||||||||| |||||||  |||  ||||   
3'        guacuu g  acuacauaagguaggg acgugug  uug  gucg  c
   -ggugua      a gu                c       gu   ac    ac 
Get sequence
Deep sequencing
608 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr7: 14340407-14340513 [+]
intergenic
Database links

Mature sequence vvi-miR2950-5p

Accession MIMAT0018009
Previous IDsvvi-miR2950
Sequence

25 - 

uuccaucucuugcacacugga

 - 45

Get sequence
Deep sequencing368 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence vvi-miR2950-3p

Accession MIMAT0018010
Previous IDsvvi-miR2950*
Sequence

66 - 

uggugugcacgggauggaaua

 - 86

Get sequence
Deep sequencing239 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20230504 "Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis" Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, Burgyan J Plant J. 62:960-976(2010).