Stem-loop sequence vvi-MIR3624

AccessionMI0016017 (change log)
DescriptionVitis vinifera miR3624 stem-loop
Literature search

2 open access papers mention vvi-MIR3624
(6 sentences)

Stem-loop
   g                   u    uaucu     a       -c       -          a           cuaugguggcuucucugcuggguuaa 
5'  gguaguaugcugcugucuu agaa     ggaug aguuuau  ucugcaa gguggcaaga caucaagagua                          g
    ||||||||||||||||||| ||||     ||||| |||||||  ||||||| |||||||||| |||||||||||                           
3'  ucaucauacgacgacggga ucuu     cuuac ucgagua  agacguu ccaccguuuu guaguucucau                          g
   u                   c    cgacu     c       cu       u          g           aacuauaguuuaguggggucuucuuc 
Get sequence
Deep sequencing
8513 reads, 500 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr8: 2139190-2139391 [+]
intergenic
Database links

Mature sequence vvi-miR3624-5p

Accession MIMAT0018011
Previous IDsvvi-miR3624*
Sequence

4 - 

uaguaugcugcugucuuuaga

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence vvi-miR3624-3p

Accession MIMAT0018012
Previous IDsvvi-miR3624
Sequence

181 - 

ucagggcagcagcauacuacu

 - 201

Get sequence
Deep sequencing8459 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20230504 "Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis" Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, Burgyan J Plant J. 62:960-976(2010).