Stem-loop sequence vvi-MIR3629a

AccessionMI0016022 (change log)
DescriptionVitis vinifera miR3629a stem-loop
Literature search

2 open access papers mention vvi-MIR3629a
(2 sentences)

Stem-loop
   u          cg                    a     ---u g  uuua     uuaucgacuuggauugugcugcuaguugcugcacauu 
5'  uuuuuuuucc  cauuuucucagcagccaagc gagug    g gg    agaga                                     u
    ||||||||||  |||||||||||||||||||| |||||    | ||    |||||                                     u
3'  aagaaaaagg  guaaaagagucgucgguuug uucac    u cc    ucucu                                     c
   a          au                    a     uauu g  ----     auguuuagguuugggucaaccuuggugaacuuugggu 
Get sequence
Deep sequencing
382 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr13: 18253988-18254169 [+]
intergenic
Database links

Mature sequence vvi-miR3629a-5p

Accession MIMAT0018021
Previous IDsvvi-miR3629a*
Sequence

12 - 

cgcauuuucucagcagccaag

 - 32

Get sequence
Deep sequencing41 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence vvi-miR3629a-3p

Accession MIMAT0018022
Previous IDsvvi-miR3629a
Sequence

154 - 

ggcugcugagaaaauguagga

 - 174

Get sequence
Deep sequencing187 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20230504 "Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis" Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, Burgyan J Plant J. 62:960-976(2010).