Stem-loop sequence vvi-MIR3629b

AccessionMI0016023 (change log)
DescriptionVitis vinifera miR3629b stem-loop
Literature search

2 open access papers mention vvi-MIR3629b
(2 sentences)

Stem-loop
   uuug     g   ---gg          a    ---a   gguu        uuu aa 
5'     uuuuc ucc     uuucucagca ccaa    cag    cauucgau   g  a
       ||||| |||     |||||||||| ||||    |||    ||||||||   |   
3'     gggag agg     aaagagucgu gguu    guc    guaggcua   c  u
   ---a     a   augua          c    gugg   ----        cau cu 
Get sequence
Deep sequencing
218 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr14: 3031525-3031629 [+]
intergenic
Database links

Mature sequence vvi-miR3629b

Accession MIMAT0018023
Sequence

78 - 

ggcugcugagaaaauguagga

 - 98

Get sequence
Deep sequencing206 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20230504 "Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis" Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, Burgyan J Plant J. 62:960-976(2010).