Stem-loop sequence vvi-MIR3629c

AccessionMI0016024 (change log)
DescriptionVitis vinifera miR3629c stem-loop
Literature search

2 open access papers mention vvi-MIR3629c
(2 sentences)

Stem-loop 
      g     c          a  -u        c  ugaagcuugaggacauaaaaauagg 
5' ucu uuugg ugcugagaaa ug  aggaaaag ga                         u
   ||| ||||| |||||||||| ||  |||||||| ||                         u
3' agg aaacc augacucuuu ac  uccuuuuc cu                         g
      g     a          -  uu        -  uucucccguugucggcagaguuugg
Get sequence
Deep sequencing
216 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr17: 822213-822334 [+]
intergenic
Database links

Mature sequence vvi-miR3629c

Accession MIMAT0018024
Sequence

8 -  

ggcugcugagaaaauguagga

 - 28

Get sequence
Deep sequencing189 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20230504 "Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis" Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, Burgyan J Plant J. 62:960-976(2010).