Stem-loop sequence vvi-MIR3633a

AccessionMI0016032 (change log)
DescriptionVitis vinifera miR3633a stem-loop
Gene family MIPF0000403; MIR482
Literature search

2 open access papers mention vvi-MIR3633a
(3 sentences)

Stem-loop
       u      ugaau           aa    -     a    -      ag    ccucuuaua       u       uc 
5' gaaa gggaga     auuucgaaagc  uagg aaugg uggu uaggag  aacu         uauuucu caucuuc  c
   |||| ||||||     |||||||||||  |||| ||||| |||| ||||||  ||||         ||||||| |||||||   
3' cuuu cccucu     uaaagcuuuug  aucc uuacc acca auccuu  uuga         gugaagg guagagg  g
       u      ---uu           gc    c     c    u      gg    --------c       u       cc 
Get sequence
Deep sequencing
17520 reads, 950 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr17: 5521907-5522061 [+]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR3633a
vvi-MIR3633bchr17: 5521567-5521678 [+]
vvi-MIR3633achr17: 5521907-5522061 [+]
vvi-MIR482chr17: 5523024-5523140 [+]
Database links

Mature sequence vvi-miR3633a-5p

Accession MIMAT0018037
Previous IDsvvi-miR3633a
Sequence

32 - 

ggaauggaugguuaggagag

 - 51

Get sequence
Deep sequencing13011 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence vvi-miR3633a-3p

Accession MIMAT0018038
Previous IDsvvi-miR3633a*
Sequence

108 - 

uuccuauaccacccauucccua

 - 129

Get sequence
Deep sequencing4208 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20230504 "Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis" Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, Burgyan J Plant J. 62:960-976(2010).