Stem-loop sequence vvi-MIR3634

AccessionMI0016033 (change log)
DescriptionVitis vinifera miR3634 stem-loop
Literature search

3 open access papers mention vvi-MIR3634
(7 sentences)

Stem-loop
       u     uu g       u       au      --        -aa   gu 
5' aggg ggagu  u ugaagcu auggcau  guguga  cggaaaga   ggu  u
   |||| |||||  | ||||||| |||||||  ||||||  ||||||||   |||   
3' uccc ccuca  a acuuugg ugccgua  cacgcu  gccuuucu   cua  u
       u     cu g       u       cu      ca        gua   aa 
Get sequence
Deep sequencing
1917 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr17: 5681205-5681313 [-]
intergenic
Database links

Mature sequence vvi-miR3634-5p

Accession MIMAT0018039
Previous IDsvvi-miR3634*
Sequence

25 - 

ggcauaugugugacggaaaga

 - 45

Get sequence
Deep sequencing111 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence vvi-miR3634-3p

Accession MIMAT0018040
Previous IDsvvi-miR3634
Sequence

65 - 

uuuccgacucgcacucaugccgu

 - 87

Get sequence
Deep sequencing1222 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20230504 "Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis" Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, Burgyan J Plant J. 62:960-976(2010).