Stem-loop sequence vvi-MIR3633b

AccessionMI0016034 (change log)
DescriptionVitis vinifera miR3633b stem-loop
Literature search

2 open access papers mention vvi-MIR3633b
(5 sentences)

Stem-loop
         ag  cc               -     u     ---    --cuu      a 
5' ucccgg  gc  augggaauggguggc uggga cuaau   guuu     cacauc u
   ||||||  ||  ||||||||||||||| ||||| |||||   ||||     |||||| g
3' agggcc  ug  uauccuuaccuaccg acccu gguug   cgaa     guguag u
         cu  -c               u     u     agu    aaacu      a 
Get sequence
Deep sequencing
818 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr17: 5521567-5521678 [+]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR3633b
vvi-MIR3633bchr17: 5521567-5521678 [+]
vvi-MIR3633achr17: 5521907-5522061 [+]
vvi-MIR482chr17: 5523024-5523140 [+]
Database links

Mature sequence vvi-miR3633b-5p

Accession MIMAT0018041
Previous IDsvvi-miR3633b
Sequence

16 - 

ggaauggguggcugggaucua

 - 36

Get sequence
Deep sequencing368 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence vvi-miR3633b-3p

Accession MIMAT0018042
Previous IDsvvi-miR3633b*
Sequence

79 - 

guucccaugccauccauuccua

 - 100

Get sequence
Deep sequencing447 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20230504 "Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis" Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, Burgyan J Plant J. 62:960-976(2010).