Stem-loop sequence vvi-MIR3637

AccessionMI0016037 (change log)
DescriptionVitis vinifera miR3637 stem-loop
Literature search

1 open access papers mention vvi-MIR3637
(1 sentences)

Stem-loop
   u    ug   a   u  ga    u                                                uguuuggauaguuugauuuugaaacugac 
5'  gaca  aug cau au  guaa auuuuauaaaauuaaggguauuuauguauuguguuuugucggaaaaua                             a
    ||||  ||| ||| ||  |||| ||||||||||||||||||||||||||||||||||||||||||||||||                              
3'  cugu  uac gua ug  uauu uaaaauauuuuaauucucguaaauacguaacacagaacagcuuuuuau                             u
   g    gu   c   -  ag    -                                                cauaauagguuauuaugucagccuuauau 
Get sequence
Deep sequencing
983 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr16: 20659651-20659852 [-]
intergenic
Database links

Mature sequence vvi-miR3637-5p

Accession MIMAT0018047
Previous IDsvvi-miR3637*
Sequence

44 - 

auuuauguauuguguuuugucgga

 - 67

Get sequence
Deep sequencing664 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence vvi-miR3637-3p

Accession MIMAT0018048
Previous IDsvvi-miR3637
Sequence

137 - 

uuucgacaagacacaaugcauaaa

 - 160

Get sequence
Deep sequencing307 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20230504 "Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis" Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, Burgyan J Plant J. 62:960-976(2010).