Stem-loop sequence vvi-MIR3639

AccessionMI0016039 (change log)
DescriptionVitis vinifera miR3639 stem-loop
Literature search

2 open access papers mention vvi-MIR3639
(8 sentences)

Stem-loop
     u       uc   u   --         auacacga g      cg           c      a    -                  a                  aa 
5' gu caaaagc  uug uga  auaacaaug        u aagcuu  uuauaaaaaaa uuuuaa accu guuuggauugacuucuga aggcuaaaagcucuuauu  g
   || |||||||  ||| |||  |||||||||        | ||||||  ||||||||||| |||||| |||| |||||||||||||||||| ||||||||||||||||||  c
3' ca guuuucg  aac acu  uauuguugc        a uuugaa  aauauuuuuuu aaaauu ugga caaaccuaacugaagacu uucgguuuucgagaauaa  u
     u       -c   u   au         ------aa g      au           -      c    a                  c                  au 
Get sequence
Deep sequencing
111 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr9: 21823006-21823219 [+]
intergenic
Database links

Mature sequence vvi-miR3639-5p

Accession MIMAT0018051
Previous IDsvvi-miR3639
Sequence

76 - 

auugacuucugaaaggcuaaaagc

 - 99

Get sequence
Deep sequencing17 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence vvi-miR3639-3p

Accession MIMAT0018052
Previous IDsvvi-miR3639*
Sequence

119 - 

gagcuuuuggcuucucagaaguca

 - 142

Get sequence
Deep sequencing25 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20230504 "Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis" Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, Burgyan J Plant J. 62:960-976(2010).